ID: 1081626226_1081626234

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1081626226 1081626234
Species Human (GRCh38) Human (GRCh38)
Location 11:44656893-44656915 11:44656945-44656967
Sequence CCAAAGAAACAAAAGTGCCACTA GTGGGCCGGAATAGAACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!