ID: 1081675207_1081675215

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1081675207 1081675215
Species Human (GRCh38) Human (GRCh38)
Location 11:44964664-44964686 11:44964706-44964728
Sequence CCACGCCTGCAGACACCTGCTCC CGGGGTGATCAGCTCTGCAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!