ID: 1081794383_1081794390

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1081794383 1081794390
Species Human (GRCh38) Human (GRCh38)
Location 11:45809567-45809589 11:45809612-45809634
Sequence CCTGGACCGATCTGGACTTCAGG GGAGAGTAGATTGGCTGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67} {0: 1, 1: 0, 2: 3, 3: 34, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!