ID: 1081812852_1081812872

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1081812852 1081812872
Species Human (GRCh38) Human (GRCh38)
Location 11:45923027-45923049 11:45923080-45923102
Sequence CCCGGCCCGCTCATGCCACGTGT CGCCCTCGACGGAGACCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82} {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!