ID: 1081812865_1081812876

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1081812865 1081812876
Species Human (GRCh38) Human (GRCh38)
Location 11:45923054-45923076 11:45923090-45923112
Sequence CCAGACGGGAGGCTGCGGAGAGC GGAGACCCGGGGGCCGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161} {0: 1, 1: 0, 2: 3, 3: 38, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!