ID: 1081998306_1081998313

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1081998306 1081998313
Species Human (GRCh38) Human (GRCh38)
Location 11:47378265-47378287 11:47378290-47378312
Sequence CCGAGGGCCACGGGTTGGGCTGG GAGGAGTCCCGGTACTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 286} {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!