ID: 1082086851_1082086864

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1082086851 1082086864
Species Human (GRCh38) Human (GRCh38)
Location 11:48057512-48057534 11:48057556-48057578
Sequence CCAGTCACGGGCAGCCTTGGGTA GTCGAGGCAGGTGGTGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81} {0: 1, 1: 0, 2: 1, 3: 52, 4: 877}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!