ID: 1082086853_1082086863

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1082086853 1082086863
Species Human (GRCh38) Human (GRCh38)
Location 11:48057526-48057548 11:48057553-48057575
Sequence CCTTGGGTACCCAGAGGCCTTCT TGGGTCGAGGCAGGTGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211} {0: 1, 1: 0, 2: 2, 3: 47, 4: 572}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!