ID: 1082131458_1082131459

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1082131458 1082131459
Species Human (GRCh38) Human (GRCh38)
Location 11:48494846-48494868 11:48494869-48494891
Sequence CCATAGTTAGCAACACAGACAAT CTGTGTATTTGAAGAGCAGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!