ID: 1082166396_1082166416

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1082166396 1082166416
Species Human (GRCh38) Human (GRCh38)
Location 11:48955580-48955602 11:48955632-48955654
Sequence CCGGGCGGGGGCTGCCCCCCACT GTCTCCTCACTTCCCAGAAGGGG
Strand - +
Off-target summary {0: 6, 1: 271, 2: 425, 3: 324, 4: 617} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!