ID: 1082166417_1082166426

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1082166417 1082166426
Species Human (GRCh38) Human (GRCh38)
Location 11:48955636-48955658 11:48955670-48955692
Sequence CCTCACTTCCCAGAAGGGGCAGC GGGGCTCCTCACTTCTCAGATGG
Strand - +
Off-target summary {0: 28, 1: 589, 2: 5155, 3: 9045, 4: 7783} {0: 1678, 1: 2039, 2: 4785, 3: 5902, 4: 5145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!