ID: 1082166421_1082166427

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1082166421 1082166427
Species Human (GRCh38) Human (GRCh38)
Location 11:48955645-48955667 11:48955671-48955693
Sequence CCAGAAGGGGCAGCTGCCGGGCG GGGCTCCTCACTTCTCAGATGGG
Strand - +
Off-target summary No data {0: 258, 1: 1867, 2: 2264, 3: 6789, 4: 6457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!