ID: 1082166429_1082166435

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1082166429 1082166435
Species Human (GRCh38) Human (GRCh38)
Location 11:48955676-48955698 11:48955691-48955713
Sequence CCTCACTTCTCAGATGGGGCAGC GGGGCAGCTGCCGGGCGGAGGGG
Strand - +
Off-target summary {0: 40, 1: 635, 2: 2227, 3: 3801, 4: 10783} {0: 207, 1: 595, 2: 988, 3: 788, 4: 1151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!