ID: 1082166429_1082166439

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1082166429 1082166439
Species Human (GRCh38) Human (GRCh38)
Location 11:48955676-48955698 11:48955715-48955737
Sequence CCTCACTTCTCAGATGGGGCAGC TCCTCACTTCCCAGACTGGGTGG
Strand - +
Off-target summary {0: 40, 1: 635, 2: 2227, 3: 3801, 4: 10783} {0: 263, 1: 2849, 2: 5811, 3: 7001, 4: 5678}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!