ID: 1082255325_1082255333

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1082255325 1082255333
Species Human (GRCh38) Human (GRCh38)
Location 11:50027535-50027557 11:50027573-50027595
Sequence CCTATGAAAGCAGCCACAGGGAC CACAGGGATGGAGCTGCCCAAGG
Strand - +
Off-target summary {0: 4, 1: 25, 2: 99, 3: 207, 4: 617} {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!