ID: 1082255326_1082255333

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1082255326 1082255333
Species Human (GRCh38) Human (GRCh38)
Location 11:50027548-50027570 11:50027573-50027595
Sequence CCACAGGGACTGTACCCTGCAGA CACAGGGATGGAGCTGCCCAAGG
Strand - +
Off-target summary {0: 4, 1: 43, 2: 81, 3: 162, 4: 437} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!