ID: 1082757916_1082757921

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1082757916 1082757921
Species Human (GRCh38) Human (GRCh38)
Location 11:57096455-57096477 11:57096502-57096524
Sequence CCAGACCCCTTCTCTTTTTTCTT GTCTCACTCTGTTGCCAGACTGG
Strand - +
Off-target summary No data {0: 62, 1: 1580, 2: 4622, 3: 9747, 4: 12440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!