ID: 1082785520_1082785529

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1082785520 1082785529
Species Human (GRCh38) Human (GRCh38)
Location 11:57314175-57314197 11:57314220-57314242
Sequence CCCAAAGCTCATGTGAGGATCTC CCATAACACCTGCTTTATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101} {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!