ID: 1082792560_1082792564

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1082792560 1082792564
Species Human (GRCh38) Human (GRCh38)
Location 11:57356803-57356825 11:57356845-57356867
Sequence CCATAATCCATTTTCTTCATCAT TGATGCAATTAGAGTGATCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 405, 4: 861} {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!