ID: 1082805336_1082805341

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1082805336 1082805341
Species Human (GRCh38) Human (GRCh38)
Location 11:57445650-57445672 11:57445703-57445725
Sequence CCCAGTAGTTGTTTCATAAATTA TGCCTACAATCCCAGCATTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!