ID: 1082805340_1082805341

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1082805340 1082805341
Species Human (GRCh38) Human (GRCh38)
Location 11:57445686-57445708 11:57445703-57445725
Sequence CCAGGAGCAGTGGCTCATGCCTA TGCCTACAATCCCAGCATTTTGG
Strand - +
Off-target summary {0: 77, 1: 2236, 2: 20170, 3: 64945, 4: 130889} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!