ID: 1082822845_1082822851

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1082822845 1082822851
Species Human (GRCh38) Human (GRCh38)
Location 11:57556251-57556273 11:57556295-57556317
Sequence CCTGCCTGGGTGTGATTCGGCTC TCTAACTAGGCCGGGCACGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 64} {0: 1, 1: 0, 2: 9, 3: 135, 4: 1243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!