ID: 1082862041_1082862049

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1082862041 1082862049
Species Human (GRCh38) Human (GRCh38)
Location 11:57866343-57866365 11:57866380-57866402
Sequence CCTTCACCTCCTTGTTGCGGAGG ATTGAGCATGGGAATTATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!