ID: 1083189078_1083189086

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1083189078 1083189086
Species Human (GRCh38) Human (GRCh38)
Location 11:61036517-61036539 11:61036547-61036569
Sequence CCTTGAATGCCCAGCTCTCCCCC GACCACACTGCACAGCCCATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!