ID: 1083332832_1083332836

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083332832 1083332836
Species Human (GRCh38) Human (GRCh38)
Location 11:61906956-61906978 11:61906973-61906995
Sequence CCATGAGAGTTCTGGGACCGCCC CCGCCCCCAGGAGCCAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93} {0: 1, 1: 0, 2: 3, 3: 37, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!