ID: 1083488433_1083488434

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083488433 1083488434
Species Human (GRCh38) Human (GRCh38)
Location 11:62997853-62997875 11:62997870-62997892
Sequence CCAAAACGGGCTGTGCACATAGC CATAGCAGATGCTCAATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 2, 1: 18, 2: 91, 3: 377, 4: 1159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!