ID: 1083673113_1083673118

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1083673113 1083673118
Species Human (GRCh38) Human (GRCh38)
Location 11:64310880-64310902 11:64310911-64310933
Sequence CCAATCTTAAACTTTGTGCACCC CTGAAGAACAGTGAGCCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81} {0: 1, 1: 0, 2: 2, 3: 24, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!