ID: 1083794543_1083794545

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083794543 1083794545
Species Human (GRCh38) Human (GRCh38)
Location 11:65007546-65007568 11:65007563-65007585
Sequence CCAGCACGTGCTTGCTGGTGCCT GTGCCTCTGTCACAGGCATGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!