ID: 1083854453_1083854462

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1083854453 1083854462
Species Human (GRCh38) Human (GRCh38)
Location 11:65385883-65385905 11:65385918-65385940
Sequence CCCCTGGGGTTCACACCATTCTC TCCCGCGTAGCTGGGACTACAGG
Strand - +
Off-target summary {0: 44, 1: 679, 2: 10061, 3: 45622, 4: 51127} {0: 392, 1: 56827, 2: 179806, 3: 270892, 4: 192530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!