ID: 1083854456_1083854462

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1083854456 1083854462
Species Human (GRCh38) Human (GRCh38)
Location 11:65385898-65385920 11:65385918-65385940
Sequence CCATTCTCCTGCCTCAGCCTTCC TCCCGCGTAGCTGGGACTACAGG
Strand - +
Off-target summary {0: 1098, 1: 63097, 2: 45452, 3: 18916, 4: 10215} {0: 392, 1: 56827, 2: 179806, 3: 270892, 4: 192530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!