ID: 1083992865_1083992880

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083992865 1083992880
Species Human (GRCh38) Human (GRCh38)
Location 11:66257712-66257734 11:66257748-66257770
Sequence CCCCTCCGACGCCACCGAGGTAG AAGGCGGCGCGGGGGCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40} {0: 1, 1: 0, 2: 2, 3: 17, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!