ID: 1083992865_1083992882

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1083992865 1083992882
Species Human (GRCh38) Human (GRCh38)
Location 11:66257712-66257734 11:66257756-66257778
Sequence CCCCTCCGACGCCACCGAGGTAG GCGGGGGCTGCTGGGAAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40} {0: 1, 1: 0, 2: 6, 3: 97, 4: 769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!