ID: 1083992865_1083992883

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1083992865 1083992883
Species Human (GRCh38) Human (GRCh38)
Location 11:66257712-66257734 11:66257759-66257781
Sequence CCCCTCCGACGCCACCGAGGTAG GGGGCTGCTGGGAAGGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40} {0: 1, 1: 0, 2: 9, 3: 75, 4: 1374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!