ID: 1084021316_1084021323

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1084021316 1084021323
Species Human (GRCh38) Human (GRCh38)
Location 11:66419991-66420013 11:66420004-66420026
Sequence CCAGGCCCCGCCCGCCGCAGCCG GCCGCAGCCGCGGCAGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 19, 3: 174, 4: 1073} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!