ID: 1084028479_1084028483

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1084028479 1084028483
Species Human (GRCh38) Human (GRCh38)
Location 11:66467128-66467150 11:66467158-66467180
Sequence CCGAGGGCGGGCGCCGGTGGCTG CCCGCGCGTCCCTGCGGTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 223} {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!