ID: 1084030796_1084030802

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1084030796 1084030802
Species Human (GRCh38) Human (GRCh38)
Location 11:66479666-66479688 11:66479692-66479714
Sequence CCTGTAAAAGTGGACCGCGGGCC CTCTGCTCTGGACTCCCTTTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!