ID: 1084044939_1084044947

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1084044939 1084044947
Species Human (GRCh38) Human (GRCh38)
Location 11:66563046-66563068 11:66563085-66563107
Sequence CCCCGAGGAGCTGCGGCGCGAGC CGAGTACTGCATCCGCCGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 131} {0: 1, 1: 0, 2: 0, 3: 1, 4: 8}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!