ID: 1084102299_1084102304

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1084102299 1084102304
Species Human (GRCh38) Human (GRCh38)
Location 11:66957857-66957879 11:66957890-66957912
Sequence CCCTCGCCTTACACGCCGCGGCT CTGAGCCACATCCAGTACGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23} {0: 1, 1: 0, 2: 0, 3: 2, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!