ID: 1084377943_1084377955

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1084377943 1084377955
Species Human (GRCh38) Human (GRCh38)
Location 11:68791275-68791297 11:68791318-68791340
Sequence CCCACTTCCCTTTGGGGACACTG GGCAACTGCCCCTCCAATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 197} {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!