ID: 1084396162_1084396169

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1084396162 1084396169
Species Human (GRCh38) Human (GRCh38)
Location 11:68911870-68911892 11:68911920-68911942
Sequence CCCTGGGTCAGGGTTTATTTGTT CCGTGTGCACGCCCGTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 190} {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!