ID: 1084398231_1084398238

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1084398231 1084398238
Species Human (GRCh38) Human (GRCh38)
Location 11:68928901-68928923 11:68928939-68928961
Sequence CCTTGGGCTTGGGGTCACAGCCC TTTTGCCAATTGAAGATCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 305} {0: 1, 1: 0, 2: 1, 3: 36, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!