ID: 1084529153_1084529166

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1084529153 1084529166
Species Human (GRCh38) Human (GRCh38)
Location 11:69716988-69717010 11:69717031-69717053
Sequence CCCCACCTAGGAAACAGGATGGA CCAGAGGGAGCCAGGCCAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 195} {0: 1, 1: 0, 2: 4, 3: 51, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!