ID: 1084806105_1084806109

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1084806105 1084806109
Species Human (GRCh38) Human (GRCh38)
Location 11:71580066-71580088 11:71580100-71580122
Sequence CCCAAATTGCAGGGATGACAGAC CATGCAGCCTCTTTTATGTCTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 427, 3: 17553, 4: 268102} {0: 2, 1: 1, 2: 2, 3: 7, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!