ID: 1084829512_1084829518

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1084829512 1084829518
Species Human (GRCh38) Human (GRCh38)
Location 11:71758105-71758127 11:71758132-71758154
Sequence CCTTCACAATGGACCTTAATATT CCTCCTGGTGTTATTCATTGTGG
Strand - +
Off-target summary {0: 7, 1: 3, 2: 5, 3: 12, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!