ID: 1084938708_1084938711

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1084938708 1084938711
Species Human (GRCh38) Human (GRCh38)
Location 11:72601064-72601086 11:72601091-72601113
Sequence CCAGGCATCAGTAAGCAGCCAAG TTGCTGAGCCCATCCTCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 212} {0: 1, 1: 0, 2: 3, 3: 24, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!