ID: 1084971030_1084971044

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1084971030 1084971044
Species Human (GRCh38) Human (GRCh38)
Location 11:72772162-72772184 11:72772213-72772235
Sequence CCCTGTGCCCGGTGCTGCCATAG TGCCATAGCCATAGTGGGCATGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 6, 3: 19, 4: 153} {0: 1, 1: 1, 2: 0, 3: 11, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!