ID: 1085084319_1085084330

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1085084319 1085084330
Species Human (GRCh38) Human (GRCh38)
Location 11:73656629-73656651 11:73656649-73656671
Sequence CCCCAGAACTCAGCACAGGGCCT CCTGGCATGGGGTGGGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 28, 3: 222, 4: 1016} {0: 1, 1: 1, 2: 97, 3: 731, 4: 2429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!