|
Left Crispr |
Right Crispr |
| Crispr ID |
1085084321 |
1085084330 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:73656631-73656653
|
11:73656649-73656671
|
| Sequence |
CCAGAACTCAGCACAGGGCCTGG |
CCTGGCATGGGGTGGGTGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 41, 3: 274, 4: 1113} |
{0: 1, 1: 1, 2: 97, 3: 731, 4: 2429} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|