ID: 1085125449_1085125458

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1085125449 1085125458
Species Human (GRCh38) Human (GRCh38)
Location 11:73999049-73999071 11:73999080-73999102
Sequence CCCCCCGAGTAGCTGGGACCGCA TCACCATGCCTGGCTAAAAAGGG
Strand - +
Off-target summary {0: 42, 1: 4308, 2: 74136, 3: 197990, 4: 269278} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!