|
Left Crispr |
Right Crispr |
| Crispr ID |
1085171813 |
1085171817 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:74456118-74456140
|
11:74456168-74456190
|
| Sequence |
CCAGCCTGGGCAACATGTGAAAC |
ATATATATATATAAATTAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 34, 1: 326, 2: 1368, 3: 11678, 4: 72278} |
{0: 2, 1: 68, 2: 219, 3: 1203, 4: 5403} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|